.
Computational Biology Research Group University of Oxford
.
.
. Bioinformatics Frequently Asked Questions .
. .
.
 
CBRG Home
CBRG Accounts (molbiol)
Analysis tools
Training courses
Tutorials
Unix help
Examples
Papers
Collaborative data
Presentations
Oxford-only section
FAQ: CBRG + UNIX
FAQ: Bioinformatics
Links
 
 
 

SITE MAP

Bioinformatics FAQ

There are a large number of bioinformatics programs available to CBRG account holders via this web site. These examples (Frequently Asked Questions) are used to illustrate the use of these tools in answering typical queries posed by researchers.

The major web-based tools from the CBRG are listed, here.


Which enzymes do not cut my sequence?

Program name: remap     

(molbiol username / password required)

Notes: This program may be used to display a sequence with restriction enzymes and translation. Importantly in this context, the display is followed by a list of enzymes that restrict the sequence (and their frequency) as well as a list of those enzymes that did not cut within the sequence.
In addition, remap can be told to report any enzymes that cut less than a minimum number of cuts (and/or above a maximum number of cuts) within the sequence - these values of these minimum and maximum cut-offs can be set by the user.

Example output from remap.

                         NlaIV        BsaXI
          GsuI           | Hpy178III  | TstI                      SfeI
          Eco57MI        | |  MwoI    | | Hpy178III NspI          |TspRI
                                                          \
          tatattacacaaaggctccagaagccgactatcttgaagcatgtgtggtgtcagtgctac
                   1870      1880      1890      1900      1910      1920      
          ----:----|----:----|----:----|----:----|----:----|----:----|
          Y  I  T  Q  R  L  Q  K  P  T  I  L  K  H  V  W  C  Q  C  Y  
           I  L  H  K  G  S  R  S  R  L  S  *  S  M  C  G  V  S  A  T 
            Y  Y  T  K  A  P  E  A  D  Y  L  E  A  C  V  V  S  V  L  Q

Back to FAQs



Search CBRG web site:

CBRG support

This file last modified Friday March 09, 2007