.
Computational Biology Research Group University of Oxford
.
.
. Bioinformatics Frequently Asked Questions .
. .
.
 
CBRG Home
CBRG Accounts (molbiol)
Analysis tools
Training courses
Tutorials
Unix help
Examples
Papers
Collaborative data
Presentations
Oxford-only section
FAQ: CBRG + UNIX
FAQ: Bioinformatics
Links
 
 
 

SITE MAP

Bioinformatics FAQ

There are a large number of bioinformatics programs available to CBRG account holders via this web site. These examples (Frequently Asked Questions) are used to illustrate the use of these tools in answering typical queries posed by researchers.

The major web-based tools from the CBRG are listed, here.


Can I prepare a sequence figure for publication?

Program name: showseq     

(molbiol username / password required)

Notes: Nucleotide sequences can be prepared for publication by displaying translated regions (any combination of frames), any or all restriction sites and any annotation in context. In addition, regions of both nucleotide and protein sequences can be highlighted using uppercase letters or by displaying with colours (when the output is formated as html). Features derived from EMBL or UniProt-SwissProt entries can also be displayed.

Figure 1, Example output from showseq - used to illustrate an annotation, translation of a defined region, uppercase highlighting of a defined region and a restriction enzyme site.

            M  T  S  S  L  L  L  A  F  L  L  L  A  P  T  T  V  A  T  P  R  
     cccagcaATGACCTCCTCATTGCTTCTGGCCTTTCTCCTCCTGGCTCCAACCACAGTGGCCACTCCCAGA
     ----:----|----:----|----:----|----:----|----:----|----:----|----:----|
              10        20        30        40        50        60        70
            |----------------------------------------------------|
            sig peptide

     A  G  G  Q  C  P  A  C  G  G  P  T  L  E  L  E  S  Q  R  E  L  L  L  D
     GCTGGCGGTCAGTGTCCAGCATGTGGGGGGCCCACCTTGGAACTGGAGAGCCAGCGGGAGCTGCTTCTTG
     ----:----|----:----|----:----|----:----|----:----|----:----|----:----|
              80        90        100       110       120       130       140
 
                                                     EcoRI
                                                     \
       L  A  K  R  S  I  L  D  *                                           
     ATCTGGCCAAGAGAAGCATCTTGGACTAGctgcacctcacccagcgctgaattctgaaccgccctgtgtc
     ----:----|----:----|----:----|----:----|----:----|----:----|----:----|
              150       160       170       180       190       200       210


Figure 2, Example output from showseq - using the pre-defined display format: "Baroque"

          P  S  N  D  L  L  I  A  S  G  L  S  P  P  G  S  N  H  S  G  
           P  A  M  T  S  S  L  L  L  A  F  L  L  L  A  P  T  T  V  A 
            Q  Q  *  P  P  H  C  F  W  P  F  S  S  W  L  Q  P  Q  W  P
                   10        20        30        40        50        60        
          ----:----|----:----|----:----|----:----|----:----|----:----|
                                             CspCI
                     BsrDI                   | CjeI             Tsp4CI
                     |    BsrDI              | |BssKI           | CfrI 
                     |    |    MnlI          | |EcoRII          | AceIII
                     |    |    |  MnlI       | || AeuI          | | BalI 
                     |    |    |  |BseRI     | || ScrFI         | | HaeI 
                     |    |    |  ||  HaeI   | || |  CviJI      | | CviJI
          BseYI      |    |    |  ||  CviJI  | || |  |NlaIV     | | HaeIII
          |  BseRI   |    |    |  ||  HaeIII | || |  || MnlI    | | |TspRI 
                             \         \   \          \
          CCCAGCAATGACCTCCTCATTGCTTCTGGCCTTTCTCCTCCTGGCTCCAACCACAGTGGC
          ----:----|----:----|----:----|----:----|----:----|----:----|
          GGGTCGTTACTGGAGGAGTAACGAAGACCGGAAAGAGGAGGACCGAGGTTGGTGTCACCG
           /  /    /    /     /  /    /  / /       / ///    /  /    /
           |  |    |    BsrDI |  |    |  | CspCI   | ||MnlI |  |    HaeIII
           |  |    BsrDI      |  |    |  CjeI      | |NlaIV |  |    CviJI
           |  BseYI           |  |    HaeIII       | EcoRII |  |    HaeI 
           BseRI              |  |    CviJI        | CviJI  |  |    BalI
                              |  |    HaeI         | BssKI  |  Tsp4CI
                              |  BseRI             ScrFI    TspRI
                              |  MnlI              AeuI
                              MnlI
          ----:----|----:----|----:----|----:----|----:----|----:----|
           G  L  L  S  R  R  M  A  E  P  R  E  G  G  P  E  L  W  L  P 
          X  W  C  H  G  G  *  Q  K  Q  G  K  E  E  Q  S  W  G  C  H  
            G  A  I  V  E  E  N  S  R  A  K  R  R  R  A  G  V  V  T  A

Further reading: showseq background


Back to FAQs



Search CBRG web site:

CBRG support

This file last modified Friday March 09, 2007